Sequence ID | >FG091800002 |
Genome ID | AE016817 |
Search identical group | |
Phylum/Class | Ascomycota |
Species | Ashbya gossypii ATCC 10895 |
Chromosome | chr4 |
Start position on genome | 920209 |
End posion on genome | 920112 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
caattggtggaatatgagatatttgcactggcggctaaatgcccacttttgtggcaggtcctttatatgtgtcaatatgtcacctctctgacagaaaata |
tRNA gene sequence |
GAGAGTTTGGCCGAGTGGTTAAGGCGTCAGATTTAGGCTCTGATATCTACGGATTCGCGG |
Downstream region at tRNA end position |
tttttgtctgtttgccagcacgctgtagaccaagtgctgggtctttcgggcaggctgggctgcagtcttcgtattcaggtatccatggttatatattgtt |
Secondary structure (Cloverleaf model) | >FG091800002 Leu TAG a Atta tttttgtctgtttgccagcacgctgtagaccaagtgctgggtctttcgggcaggctgggctgcagtcttcgtattcaggtatccatggttatatattgtt G - C A - T G - C A - T G - C T + G T - A T A T T G C C C A T G A G + | | | | G G G C C G G C G G G C G | | | T T T A G G C T A G TATCTACGGATTC T - A C - G A - T G - C A - T T C T G * T A G intron: position=38, length=17 (in A-loop) CTCCTCTTAAGCAAGAT |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |