Sequence ID | >W10103311 |
Genome ID | ACQE01000173 |
Search identical group | |
Phylum/Class | Fusobacteriota |
Species | Fusobacterium animalis 3_1_33 [ACQE] |
Start position on genome | 6 |
End posion on genome | 81 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
nnnnngattt |
tRNA gene sequence |
GCTTCCTTAGCTCAGTCGGTAGAGCATGCGGCTGTTAACCGCAGCGTCAATGGTTCGAGT |
Downstream region at tRNA end position |
ttttaaatat |
Secondary structure (Cloverleaf model) | >W10103311 Asn GTT t GCCA ttttaaatat G - C C - G T - A T - A C - G C - G T - A T G T T T A C C A T G A A | | | | | G C C T C G A A T G G C G | | | | T T G G A G C T A A GCGTC T - A G - C C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |