Sequence ID | >W10105784 |
Genome ID | ACXV01000006 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Thiomonas intermedia K12 [ACXV] |
Start position on genome | 1374 |
End posion on genome | 1299 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
ggctggcttc |
tRNA gene sequence |
GCCGGTGTAGCTCAGTTGGTAGAGCAGCGCATTCGTAATGCGAAGGTCGAGGGTTCGACT |
Downstream region at tRNA end position |
aaaaactaag |
Secondary structure (Cloverleaf model) | >W10105784 Thr CGT c ACCA aaaaactaag G - C C - G C - G G - C G - C T - A G - C T C T T T T C C A T G A A + | + | | G T C T C G G A G G G C G | | | | T T G G A G C T A A AGGTC G A C - G G - C C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |