Sequence ID | >W10105955 |
Genome ID | ACXY01000032 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Thermoanaerobacter ethanolicus CCSD1 [ACXY] |
Start position on genome | 235 |
End posion on genome | 310 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aaataaatat |
tRNA gene sequence |
GGGCCTTTAGCTCAGCTGGCAGAGCGGTCGGCTCATAACCGATTGGTCCGGGGTTCAAAT |
Downstream region at tRNA end position |
tttcaataaa |
Secondary structure (Cloverleaf model) | >W10105955 Met CAT t ACCA tttcaataaa G - C G - C G - C C - G C - G T - A T - A T A T G T C C C A C G A A | + | | | A T C T C G C G G G G C G | | | | T T G G A G C C A G TGGTC G + T T - A C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |