Sequence ID | >W1510012086 |
Genome ID | BBNC01000027 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudomonas putida YKD221 [BBNC] |
Start position on genome | 51448 |
End posion on genome | 51523 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
tcacctcgtc |
tRNA gene sequence |
GCCCAGATAGCTCAGTCGGTAGAGCAGAGGATTGAAAATCCTCGTGTCGGCGGTTCGACT |
Downstream region at tRNA end position |
ccttcaagct |
Secondary structure (Cloverleaf model) | >W1510012086 Phe GAA c ACCA ccttcaagct G - C C - G C - G C - G A - T G - C A - T T C T C T G C C A T G A A | + | | | G C C T C G G G C G G C G | | | | T T G G A G C T A A GTGTC G - C A - T G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |