Sequence ID | >W1510013006 |
Genome ID | BBNU01000003 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Algibacter lectus JCM 19274 [BBNU] |
Start position on genome | 157675 |
End posion on genome | 157601 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ctccaatttc |
tRNA gene sequence |
GGTCCCATAGCTCAGTTGGTTAGAGCACCTGACTCATAATCAGGTGGTCCTTGGTTCGAG |
Downstream region at tRNA end position |
agagattgta |
Secondary structure (Cloverleaf model) | >W1510013006 Met CAT c ACat agagattgta G - C G - C T - A C - G C - G C - G A - T C G T G A A C C A T G A A | | | | | G T C T C G C T T G G C G | | | | T T G G A G C T T A A TGGTC C - G C - G T - A G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |