Sequence ID | >W1510013663 |
Genome ID | BBPH01000031 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Paracoccus sp. PAMC 22219 [BBPH] |
Start position on genome | 48427 |
End posion on genome | 48343 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
cgcgggcagc |
tRNA gene sequence |
GCGGGTATGGCGAAATTGGCAGACGCACCAGATTTAGGTTCTGGCGCCGCAAGGCGTGGG |
Downstream region at tRNA end position |
ccactgatcg |
Secondary structure (Cloverleaf model) | >W1510013663 Leu TAG c ACCA ccactgatcg G - C C - G G - C G - C G - C T - A A - T T G T C T C C C A T A A G | + | | | A T A G C G G G G G G C G | | | T T G A C G C C A G A CGCCGCAAGGCGT C - G C - G A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |