Sequence ID | >W1510014430 |
Genome ID | BBPX01000020 |
Phylum/Class | Spirochaetota |
Species | Treponema endosymbiont of Eucomonympha sp. of Eucomonympha sp. D2 [BBPX] |
Start position on genome | 8705 |
End posion on genome | 8794 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tacaatataT |
tRNA gene sequence |
GCCGAGATGGTGAAATTGGTAGACACAAGAGACTTAAAATTTCTCGATTTGAAAAAAAAT |
Downstream region at tRNA end position |
atattgtaat |
Secondary structure (Cloverleaf model) | >W1510014430 Leu TAA T AAtc atattgtaat G - C C - G C - G G - C A - T G - C A - T T G T T G G C C A T A A G + | | | | A T A G T G G C C G G C G | | | T T G A C A C T A G A CGATTTGAAAAAAAATCGT A - T G - C A - T G + T A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |