Sequence ID | >W1510014448 |
Genome ID | BBPX01000142 |
Phylum/Class | Spirochaetota |
Species | Treponema endosymbiont of Eucomonympha sp. of Eucomonympha sp. D2 [BBPX] |
Start position on genome | 23687 |
End posion on genome | 23601 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cgagcctgcT |
tRNA gene sequence |
GGAAAGATGACCGAGTGGTCGAAGGTGCACGACTGGAAATCGTGTGTGCCGCAAGGTACC |
Downstream region at tRNA end position |
gaacatgcgc |
Secondary structure (Cloverleaf model) | >W1510014448 Ser GGA T GTag gaacatgcgc G - C G - C A - T A - T A - T G - C A - T T A T C T C C C A T G A G | + | | | G G G C C A G G G G G C G | | | T T T A G G T C G A G TGTGCCGCAAGGTACC C - G A - T C - G G - C A - T C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |