Sequence ID | >W1510014477 |
Genome ID | BBPY01000022 |
Phylum/Class | Spirochaetota |
Species | Treponema endosymbiont of Eucomonympha sp. of Eucomonympha sp. E12 [BBPY] |
Start position on genome | 42151 |
End posion on genome | 42068 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tctgcaattT |
tRNA gene sequence |
GCGGCGGTGGTGGAATTGGTAGACACGCCAGCTTGAGGTGCTGGTGGCGCAAGCTATGCA |
Downstream region at tRNA end position |
agtataaggc |
Secondary structure (Cloverleaf model) | >W1510014477 Leu GAG T AAac agtataaggc G - C C - G G - C G - C C - G G - C G + T T G T T G T T C A T A A G + | | | | A T G G T G G C A A G C G | | | T T G A C A C T A G G TGGCGCAAGCTAT C - G C - G A - T G - C C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |