Sequence ID | >W1510014491 |
Genome ID | BBPY01000119 |
Phylum/Class | Spirochaetota |
Species | Treponema endosymbiont of Eucomonympha sp. of Eucomonympha sp. E12 [BBPY] |
Start position on genome | 1773 |
End posion on genome | 1857 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gtattcttaT |
tRNA gene sequence |
GCCGACATGGTGGAATGGCAGACACGATAGACTCAAAATCTATTGCGCGCAAGCGTGTGA |
Downstream region at tRNA end position |
atttttatac |
Secondary structure (Cloverleaf model) | >W1510014491 Leu CAA T AGga atttttatac G - C C - G C - G G - C A - T C - G A - T T G T C T C T C A T A A G | | | | | A G G G T G G A G A G C G | | | T T C A C A C A G G TGCGCGCAAGCGTGT A - T T - A A - T G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |