Sequence ID | >W1510014883 |
Genome ID | BBQJ01000055 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudomonas abietaniphila KF701 [BBQJ] |
Start position on genome | 29697 |
End posion on genome | 29621 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gcctgactga |
tRNA gene sequence |
GGGCCTATAGCTCAGTTGGTTAGAGCAGAGGACTCATAATCCTTTGGTCCACGGTTCGAG |
Downstream region at tRNA end position |
ccttcaaagc |
Secondary structure (Cloverleaf model) | >W1510014883 Met CAT a ACCA ccttcaaagc G - C G - C G - C C - G C - G T + G A - T T G T G T G C C A T G A A | | | | | G T C T C G C A C G G C G | | | | T T G G A G C T T A A TGGTC G + T A - T G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |