Sequence ID | >W1510016758 |
Genome ID | BBSR01000006 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Acinetobacter nosocomialis LMG 10619 [BBSR] |
Start position on genome | 18679 |
End posion on genome | 18754 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
acaggccatc |
tRNA gene sequence |
GGCGTGATAGCTCAGTAGGTAGAGCAACGGATTGAAAATCCGTGTGTCCCCAGTTCGATC |
Downstream region at tRNA end position |
tattcgaaaa |
Secondary structure (Cloverleaf model) | >W1510016758 Phe GAA c ACCA tattcgaaaa G - C G - C C - G G - C T T G - C A - T C T T G G G T C A T G A A | | | | | G A C T C G C C C A G C G | | | | T T G G A G C T A A GTGTC A - T C - G G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |