Sequence ID | >W1510052954 |
Genome ID | CCRI01000003 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Neorhizobium galegae bv. officinalis [CCRI] |
Start position on genome | 430003 |
End posion on genome | 429930 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
cgcgccctgc |
tRNA gene sequence |
TGGGGAATAGTTCAACGGTAGAACGACGGACTCTGACTCCGTTAATCTTGGTTCGAATCC |
Downstream region at tRNA end position |
ttcttcattt |
Secondary structure (Cloverleaf model) | >W1510052954 Gln CTG c GCCA ttcttcattt T - A G - C G - C G - C G - C A - T A - T T A T G G A C C A A A A | + | | | G C C T T G C T T G G C G | | | | T T G G A A C T A G TAAT A - T C - G G - C G - C A - T C C T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |