Sequence ID | >W1510061416 |
Genome ID | CCYJ01000020 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Tessaracoccus massiliensis SIT6 [CCYJ] |
Start position on genome | 578589 |
End posion on genome | 578663 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
aaagtgaccg |
tRNA gene sequence |
GCCCCCGTAGCTCAGGGGATAGAGCACCGCCCTCCGGAGGCGGGAGCCGAGGTTCGAATC |
Downstream region at tRNA end position |
tccatctctc |
Secondary structure (Cloverleaf model) | >W1510061416 Arg CCG g GCCG tccatctctc G - C C - G C - G C - G C - G C - G G - C T A T G C T C C A G G A A | | | | | G G C T C G C G A G G C G | | | | T T A G A G C T A A GAGC C - G C - G G - C C - G C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |