Sequence ID | >W1510072656 |
Genome ID | CDHO01000003 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Hyphomicrobium sp. GJ21 [CDHO] |
Start position on genome | 1608362 |
End posion on genome | 1608436 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
tcgcttcttc |
tRNA gene sequence |
GGGCACTTAGCTCAGCGGTAGAGCACTACCTTGACATGGTAGGGGTCAGAGGTTCGATCC |
Downstream region at tRNA end position |
tcttttaacc |
Secondary structure (Cloverleaf model) | >W1510072656 Val GAC c ACCA tcttttaacc G - C G - C G - C C - G A - T C - G T - A C T T T C T C C A G A A | | | | | G C C T C G A G A G G C G | | | | T T G G A G C T A A GGGTC C - G T - A A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |