| Sequence ID | >W1510081357 |
| Genome ID | CDSD01000031 |
| Phylum/Class | Alphaproteobacteria |
| Species | Microvirga massiliensis JC119 [CDSD] |
| Start position on genome | 15075 |
| End posion on genome | 15150 |
| Amino Acid | Glu |
| Anticodon | CTC |
| Upstream region at tRNA start position |
cccttgacca |
| tRNA gene sequence |
GCTCCCTTCGTCTAGCGGTCCAGGACGTCGCCCTCTCACGGCGAAAACAGGGGTTCGAGT |
| Downstream region at tRNA end position |
atgatctcaa |
| Secondary structure (Cloverleaf model) | >W1510081357 Glu CTC
a GCCA atgatctcaa
G - C
C - G
T - A
C - G
C - G
C - G
T - A T G
T T C C C C A
C G A C | | | | | G
G T C T G A G G G G C
G + | | | T T
T G G A C
C C A G AAAC
T - A
C - G
G - C
C - G
C - G
C C
T A
C T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |