Sequence ID | >W10115695 |
Genome ID | ADMN01000021 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Turicibacter sanguinis PC909 [ADMN] |
Start position on genome | 16396 |
End posion on genome | 16472 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
catttagaaa |
tRNA gene sequence |
CGGGAAGTGGCTCAGCTTGGTAGAGCACCTGGTTTGGGACCAGGGGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
taataagcgg |
Secondary structure (Cloverleaf model) | >W10115695 Pro TGG a ACCA taataagcgg C - G G - C G - C G - C A - T A - T G - C T A T T G T C C A C G A G + | | | | G T C T C G G C A G G C T | | | | T T G G A G C G T A A GGGTC C - G C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |