| Sequence ID | >W1510100293 |
| Genome ID | CELZ01000061 |
| Phylum/Class | Bacillota |
| Species | Moorella glycerini NMP [CELZ] |
| Start position on genome | 8196 |
| End posion on genome | 8119 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
tgaatgctgc |
| tRNA gene sequence |
CGGGATGTAGCTCAGTTTGGCTAGAGCACCTGCTTTGGGAGCAGGGGGTCGCAGGTTCAA |
| Downstream region at tRNA end position |
gcgtttttgt |
| Secondary structure (Cloverleaf model) | >W1510100293 Pro TGG
c ACCA gcgtttttgt
C - G
G - C
G - C
G - C
A - T
T - A
G - C T A
T T G T C C A
T T G A A + | | | | A
T C T C G G C A G G C
G | | | | T T
G G A G C
C T A A GGGTC
C - G
C - G
T - A
G - C
C - G
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |