Sequence ID | >W1510100555 |
Genome ID | CENA01000001 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Paeniclostridium sordellii W2946 [CENA] |
Start position on genome | 40164 |
End posion on genome | 40089 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
aacgaaatat |
tRNA gene sequence |
GGGGGTGTAGCTCAGCTGGGAGAGCACTTGCCTTGCACGCAAGGGGTCAGGAGTTCGATC |
Downstream region at tRNA end position |
gtagtatttt |
Secondary structure (Cloverleaf model) | >W1510100555 Ala TGC t ACCA gtagtatttt G - C G - C G + T G - C G + T T - A G - C C T T T C C T C A C G A A | | | | | G T C T C G A G G A G C G | | | | T T G G A G C G A A GGGTC C - G T - A T - A G - C C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |