| Sequence ID | >W10118920 |
| Genome ID | ADVF01000053 |
| Phylum/Class | Bacillota |
| Species | Cellulosilyticum lentocellum DSM 5427 [ADVF] |
| Start position on genome | 767 |
| End posion on genome | 839 |
| Amino Acid | Thr |
| Anticodon | TGT |
| Upstream region at tRNA start position |
ccatttacat |
| tRNA gene sequence |
GCCGACGTGGCTCAATTGGCAGAGCAGCTGACTTGTAATCAGCAGGTTATCGGTTCGAGT |
| Downstream region at tRNA end position |
tacgggacta |
| Secondary structure (Cloverleaf model) | >W10118920 Thr TGT
t Ttga tacgggacta
G - C
C - G
C - G
G - C
A - T
C - G
G - C T G
T T A G C C A
T A A G | | | | | G
T C T C G A T C G G C
G | | | | T T
G G A G C
C A A AGGTT
G - C
C - G
T - A
G - C
A - T
C A
T A
T G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |