Sequence ID | >W1510123262 |
Genome ID | CFOE01001051 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Mycobacterium tuberculosis G09901357 [CFOE] |
Start position on genome | 388 |
End posion on genome | 462 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
gatttcatcg |
tRNA gene sequence |
GCCTCCTTAGCTCAGTGGTAGAGCACTCGCCTTGTAAGCGAGCGGTCGTCAGTTCAATCC |
Downstream region at tRNA end position |
gcgttcgtgt |
Secondary structure (Cloverleaf model) | >W1510123262 Thr TGT g TCAA gcgttcgtgt G - C C - G C - G T + G C - G C - G T - A C T T C A G T C A G A A | | | | | A T C T C G G T C A G C G | | | | T T G G A G C T A A CGGTC C - G T - A C - G G - C C - G C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |