Sequence ID | >W10119498 |
Genome ID | ADVX01000016 |
Search identical group | |
Phylum/Class | Acidobacteriota |
Species | Granulicella mallensis MP5ACTX8 [ADVX] |
Start position on genome | 66918 |
End posion on genome | 66992 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tgtaggttga |
tRNA gene sequence |
GGCGCGGTACCCAAGTGGTAAGGGAGAGGTCTGCAAAACCTTTATGCGTCGGTTCGATCC |
Downstream region at tRNA end position |
aattgcttat |
Secondary structure (Cloverleaf model) | >W10119498 Cys GCA a TCCA aattgcttat G - C G - C C - G G - C C - G G - C G - C C T T C A G C C A G A A | | | | | G T A C C C G T C G G C G | | | T T G A G G G T A A TATGC G + T A - T G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |