| Sequence ID | >W10119517 |
| Genome ID | ADVY01000005 |
| Phylum/Class | Acidobacteria |
| Species | Acidobacterium sp. MP5ACTX9 [ADVY] MP5ACTX9 [ADVY] |
| Start position on genome | 43684 |
| End posion on genome | 43760 |
| Amino Acid | Arg |
| Anticodon | ACG |
| Upstream region at tRNA start position |
aacgcaatgt |
| tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGCATTTGGCTACGAACCAAAGGGTCGGAGGTTCGAA |
| Downstream region at tRNA end position |
tatcaagctt |
| Secondary structure (Cloverleaf model) | >W10119517 Arg ACG
t ACCA tatcaagctt
G - C
C - G
G - C
C - G
C - G
C - G
G - C T A
T C T T C C A
C G A A | + | | | G
T C T C G G G A G G C
G | | | | T T
G G A G C
A T A A GGGTC
T - A
T - A
T - A
G - C
G - C
C A
T A
A C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |