Sequence ID | >W10121488 |
Genome ID | ADYG01000017 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Cutibacterium acnes HL110PA3 [ADYG] |
Start position on genome | 7495 |
End posion on genome | 7413 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
acgccagcac |
tRNA gene sequence |
GGCAGGTTGCCCGAGTGGCCAAAGGGAGCGGTCTGTAAAACCGTCGGTTTCGCCTACGTT |
Downstream region at tRNA end position |
aacccccggg |
Secondary structure (Cloverleaf model) | >W10121488 Tyr GTA c ACgc aacccccggg G - C G - C C - G A - T G - C G - C T - A T A T C A A C C A T G A G | | | | | G G G C C C G T T G G C G | | | T T C A G G G C A A A CGGTTTCGCCTAC G + T C - G G - C G - C T - A C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |