Sequence ID | >W10122200 |
Genome ID | ADYV01000074 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Cutibacterium acnes HL046PA2 [ADYV] |
Start position on genome | 49318 |
End posion on genome | 49393 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
cagcaggcgt |
tRNA gene sequence |
GCCAACTTAGCTCAGTCGGTAGAGCGACGCTCTCGTAAAGCGTAGGTCACGGGTTCGATT |
Downstream region at tRNA end position |
cgttcccaga |
Secondary structure (Cloverleaf model) | >W10122200 Thr CGT t TCCA cgttcccaga G - C C - G C - G A - T A - T C - G T - A T T T T G C C C A T G A A | | | | | G C C T C G A C G G G C G | | | | T T G G A G C T A G AGGTC A - T C - G G - C C - G T - A C A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |