Sequence ID | >W10122294 |
Genome ID | ADYX01000023 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Cutibacterium acnes HL087PA2 [ADYX] |
Start position on genome | 27061 |
End posion on genome | 26987 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
caagagtcaa |
tRNA gene sequence |
GGCCCCGTAGCGCAGTTGGTTAGCGCGCCGCCCTGTCACGGCGGAGGTCGTGGGTTCAAG |
Downstream region at tRNA end position |
aagcggtgat |
Secondary structure (Cloverleaf model) | >W10122294 Asp GTC a GCtg aagcggtgat G - C G + T C - G C - G C - G C - G G - C T G T T A C C C A T G A A + | | | | A T C G C G G T G G G C G | | | | T T G G C G C T T A G AGGTC C - G C - G G - C C - G C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |