Sequence ID | >W10122584 |
Genome ID | ADZE01000008 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Cutibacterium acnes HL110PA1 [ADZE] |
Start position on genome | 30086 |
End posion on genome | 30162 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
tgggcacgat |
tRNA gene sequence |
GGCCGGGTAGCTCAGTTGGTAGTAGCGTTCGCCTGAAAAGTGAAAGGTCACCGGTTCGAC |
Downstream region at tRNA end position |
tgcaaatgac |
Secondary structure (Cloverleaf model) | >W10122584 Phe GAA t ACCT tgcaaatgac G - C G - C C - G C - G G - C G - C G - C C C T T G G C C A T G A A | | | | | G T C T C G A C C G G C G | | | T T G T A G C T A G G AGGTC T - A T - A C - G G + T C - G C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |