Sequence ID | >W10122879 |
Genome ID | ADZK01000022 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Cutibacterium acnes HL050PA3 [ADZK] |
Start position on genome | 33014 |
End posion on genome | 32942 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
ggaatgacat |
tRNA gene sequence |
TGGGGTATGGGGTAATTGGCAGCCCGACTGATTCTGGTTCAGTTAGTCCAGGTTCGAGTC |
Downstream region at tRNA end position |
gggaaaccaa |
Secondary structure (Cloverleaf model) | >W10122879 Gln CTG t GCgc gggaaaccaa T - A G - C G - C G - C G - C T - A A - T T G T G G T C C A T A A G | | | | | G T T G G G C C A G G C G + | | | T T G G C C C C A G TAGT A - T C - G T - A G - C A - T T T T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |