Sequence ID | >W10126574 |
Genome ID | AEDH01000004 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Sinorhizobium meliloti AK83 [AEDH] |
Start position on genome | 228806 |
End posion on genome | 228880 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gcgcagatga |
tRNA gene sequence |
TCCCTGGTAGCTCAGCGGTAGAGCACTCGACTGTTAATCGATAGGTCGCCGGTTCGAATC |
Downstream region at tRNA end position |
gtttcgaaag |
Secondary structure (Cloverleaf model) | >W10126574 Asn GTT a GCCA gtttcgaaag T - A C - G C - G C - G T + G G - C G - C T A T C G G C C A G A A | | | | | G C C T C G G C C G G C G | | | | T T G G A G C T A A AGGTC C T T - A C - G G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |