Sequence ID | >W10127139 |
Genome ID | AEEB01000001 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Ahrensia sp. R2A130 [AEEB] |
Start position on genome | 57727 |
End posion on genome | 57654 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
cacagcacat |
tRNA gene sequence |
TGGGGAATAGGTTAACGGTAGACCCACGGACTCTGACTCCGTTAGTCCTGGTTCGAATCC |
Downstream region at tRNA end position |
accttcttca |
Secondary structure (Cloverleaf model) | >W10127139 Gln CTG t GCCA accttcttca T - A G - C G - C G - C G - C A - T A - T T A T G G A C C A A A A | | | | | G C T T G G C C T G G C G + | | | T T G G A C C T A C TAGT A - T C - G G - C G - C A - T C C T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |