Sequence ID | >W1510205376 |
Genome ID | CHYV01000021 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Yersinia enterocolitica ERL023784 [CHYV] |
Start position on genome | 4818 |
End posion on genome | 4892 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
gttctaagat |
tRNA gene sequence |
GCGGGCATCGTATAATGGCTATTACCTCAGCCTTCCAAGCTGATGATGTGGGTTCGATTC |
Downstream region at tRNA end position |
agatgtgctg |
Secondary structure (Cloverleaf model) | >W1510205376 Gly TCC t TCCA agatgtgctg G - C C - G G - C G - C G - C C - G A - T T T T C A C C C A T A A C | | | | | G G T A T G G T G G G C G | | | T T C T T A C T A C TGAT T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |