| Sequence ID | >W10127970 |
| Genome ID | AEFB01000245 |
| Phylum/Class | Acidithiobacillia |
| Species | Acidithiobacillus sp. GGI-221 [AEFB] |
| Start position on genome | 246 |
| End posion on genome | 172 |
| Amino Acid | Val |
| Anticodon | CAC |
| Upstream region at tRNA start position |
tgctcacctt |
| tRNA gene sequence |
GGGCGGTTAGCTCAGCGGTAGAGCACTGCCTTCACACGGCAGGGGTCGCAGGTTCAAACC |
| Downstream region at tRNA end position |
aataaatcaa |
| Secondary structure (Cloverleaf model) | >W10127970 Val CAC
t ACCA aataaatcaa
G - C
G - C
G - C
C - G
G - C
G - C
T - A C A
T C G T C C A
G A A | | | | | A
C C T C G G C A G G C
G | | | | T T
G G A G C
T A A GGGTC
C - G
T - A
G - C
C - G
C - G
T C
T A
C A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |