Sequence ID | >W10127989 |
Genome ID | AEFB01000970 |
Search identical group | |
Phylum/Class | Acidithiobacillia |
Species | Acidithiobacillus sp. GGI-221 [AEFB] |
Start position on genome | 1424 |
End posion on genome | 1349 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
cgcgctcttg |
tRNA gene sequence |
GCCCAGGTAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCCTCGTGTCGGCGGTTCGATT |
Downstream region at tRNA end position |
aataaaacaa |
Secondary structure (Cloverleaf model) | >W10127989 Phe GAA g ACCA aataaaacaa G - C C - G C - G C - G A - T G - C G - C T T T C T G C C A T G A A | + | | | G C C T C G G G C G G C G | | | | T T G G A G C T A A GTGTC G - C A - T G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |