Sequence ID | >WENV036547 |
Genome ID | AACY021789101 |
Search identical group | |
Phylum/Class | Marine microbial communities from Global Ocean Sampling (GOS) |
Species | |
Start position on genome | 111 |
End posion on genome | 186 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
atactttcaa |
tRNA gene sequence |
GGGCGGTTAGCTCAGTTGGTAGAGCATCTCGTTTACACCGAGGGGGTCAAAGGTTCGAGT |
Downstream region at tRNA end position |
taacacgggg |
Secondary structure (Cloverleaf model) | >WENV036547 Val TAC a ACCA taacacgggg G - C G - C G - C C - G G + T G - C T - A T G T T T T C C A T G A A | | | | | G T C T C G A A A G G C G | | | | T T G G A G C T A A GGGTC T + G C - G T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |