| Sequence ID | >C10105196 |
| Genome ID | CP001924 |
| Phylum/Class | Chloroflexota |
| Species | Dehalococcoides mccartyi [CP001924] |
| Start position on genome | 174114 |
| End posion on genome | 174189 |
| Amino Acid | Val |
| Anticodon | CAC |
| Upstream region at tRNA start position |
tgagttcttt |
| tRNA gene sequence |
GGGCGGTTAGCTCAGTGGTTAGAGCACCTGCTTCACACGCAGGGGGTCAGTGGTTCAAAT |
| Downstream region at tRNA end position |
tactgtacaa |
| Secondary structure (Cloverleaf model) | >C10105196 Val CAC
t ACCA tactgtacaa
G - C
G - C
G - C
C - G
G + T
G - C
T - A T A
T T C A C C A
T G A A | | | | | A
G C T C G A G T G G C
G | | | | T T
T G A G C
T A A GGGTC
C - G
C - G
T - A
G - C
C - G
T C
T A
C A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |