Sequence ID | >C10105231 |
Genome ID | CP001924 |
Search identical group | |
Phylum/Class | Chloroflexota |
Species | Dehalococcoides mccartyi [CP001924] |
Start position on genome | 766661 |
End posion on genome | 766586 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
aaagcggcct |
tRNA gene sequence |
GCGCCTATAGCTCAGTGGATAGAGCATCGGTCTTCGGAACCGAGGGTCGTGGGTTCGAAT |
Downstream region at tRNA end position |
aatttaaagc |
Secondary structure (Cloverleaf model) | >C10105231 Arg TCG t GCCA aatttaaagc G - C C - G G - C C - G C - G T - A A - T T A T C T C C C A T G A A | | | | G G C T C G G T G G G C G | | | | T T A G A G C T A A GGGTC T - A C - G G - C G - C T - A C A T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |