Sequence ID | >W1510351464 |
Genome ID | CMHT01000015 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Streptococcus pneumoniae SMRU2998 [CMHT] |
Start position on genome | 1388 |
End posion on genome | 1460 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
cttccatttT |
tRNA gene sequence |
ACGGGCATAGTTTAAAGGTAGAACTAAGGTCTCCAAAACCTTCAGTGTGGGTTCGATTCC |
Downstream region at tRNA end position |
atagaattat |
Secondary structure (Cloverleaf model) | >W1510351464 Trp CCA T GTta atagaattat A - T C - G G - C G - C G - C C - G A - T T T T C A T C C A A A A | | + | | G A T T T G G T G G G C G + | | | T T G G A A C T A T CAGT A - T A - T G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |