Sequence ID | >C10111756 |
Genome ID | CP001769 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Spirosoma linguale DSM 74 [CP001769] |
Start position on genome | 838530 |
End posion on genome | 838606 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
cggttttgac |
tRNA gene sequence |
GGGGGATTAGCTCAGCTGGCTAGAGCGCTTCCATGGCATGGAAGAGGTCATCGGTTCGAC |
Downstream region at tRNA end position |
caacgttata |
Secondary structure (Cloverleaf model) | >C10111756 Ala GGC c ACAA caacgttata G - C G - C G + T G - C G + T A - T T - A T C T T A G C C A C G A A | | | | | G T C T C G A T C G G C G | | | | T T G G A G C C T A G AGGTC C - G T - A T - A C - G C - G A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |