Sequence ID | >C10113402 |
Genome ID | CP001936 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Thermoanaerobacter italicus Ab9 [CP001936] |
Start position on genome | 1986803 |
End posion on genome | 1986729 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
tttaattatt |
tRNA gene sequence |
GCTGGCATAGCTCAGTGGTAGAGCAGTTGATTCGTAATCAACAGGTCGTGGGTTCGAATC |
Downstream region at tRNA end position |
gctcattaat |
Secondary structure (Cloverleaf model) | >C10113402 Thr CGT t TCCA gctcattaat G - C C - G T - A G - C G - C C - G A - T T A T C A C C C A G A A | | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A A AGGTC G - C T - A T - A G - C A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |