Sequence ID | >C10113472 |
Genome ID | CP002032 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Thermoanaerobacter mathranii subsp. mathranii str. A3 [CP002032] |
Start position on genome | 1440322 |
End posion on genome | 1440247 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
aagtttcttt |
tRNA gene sequence |
CTGGGTGTGGCGCAGCTGGTAGCGCGCCAGAATGGGGTTCTGGAGGCCGGGGGTTCAAGT |
Downstream region at tRNA end position |
gtgcttacag |
Secondary structure (Cloverleaf model) | >C10113472 Pro GGG t ACCA gtgcttacag C - G T - A G - C G + T G - C T - A G - C T G T C C C C C A C G A G | | | | | A T C G C G G G G G G C G | | | | T T G G C G C T A G AGGCC C - G C - G A - T G - C A - T A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |