Sequence ID | >C11100073 |
Genome ID | FQ311875 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Glutamicibacter arilaitensis Re117 [FQ311875] |
Start position on genome | 586015 |
End posion on genome | 586091 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
tgtctaaccg |
tRNA gene sequence |
CGGGATATGGCGCAGTTTGGTAGCGCGCGTCGTTCGGGACGACGAGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
atttgatacg |
Secondary structure (Cloverleaf model) | >C11100073 Pro CGG g ACCA atttgatacg C - G G - C G - C G - C A - T T - A A - T T A T T G T C C A T G A G + | | | | A T C G C G G C A G G C T | | | | T T G G C G C G T A G AGGTC C - G G - C T - A C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |