Sequence ID | >C11100730 |
Genome ID | CP002985 |
Search identical group | |
Phylum/Class | Acidithiobacillia |
Species | Acidithiobacillus ferrivorans SS3 [CP002985] |
Start position on genome | 2422433 |
End posion on genome | 2422506 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
tttgccacat |
tRNA gene sequence |
GCGGGTGTAGTTCAATGGCAGAACCTGAGCTTCCCAAGCTCATGGCGTGGGTTCGATTCC |
Downstream region at tRNA end position |
ttaaaaaaca |
Secondary structure (Cloverleaf model) | >C11100730 Gly CCC t TCCA ttaaaaaaca G - C C - G G - C G - C G - C T - A G - C T T T T A C C C A A A A + | | | | G T C T T G G T G G G C G | | | | T T G G A A C C A C TGGC T - A G - C A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |