Sequence ID | >C11100741 |
Genome ID | CP002985 |
Search identical group | |
Phylum/Class | Acidithiobacillia |
Species | Acidithiobacillus ferrivorans SS3 [CP002985] |
Start position on genome | 2526052 |
End posion on genome | 2525978 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
tgcgggctgc |
tRNA gene sequence |
AGGCGCGTAGCTCAGGGGGAGAGCGCTACCTTGACACGGTAGAGGTCGGCGGTTCGAAAC |
Downstream region at tRNA end position |
aatcccgcac |
Secondary structure (Cloverleaf model) | >C11100741 Val GAC c ACCA aatcccgcac A - T G - C G - C C - G G - C C - G G - C A A T C C G C C A G A A | | | | | G G C T C G G G C G G C G | | | | T T G G A G C G A G AGGTC C - G T - A A - T C - G C - G T C T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |