Sequence ID | >W1510544981 |
Genome ID | CSTN01000007 |
Search identical group | |
Phylum/Class | Chlamydiota |
Species | Chlamydia trachomatis SwabB8 [CSTN] |
Start position on genome | 1038 |
End posion on genome | 963 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
ctccatcccT |
tRNA gene sequence |
GCGGTTATAGCTCAGTTGGTTAGAGCGCGACACTGATAATGTCGAGGTCCCAAGTTCAAG |
Downstream region at tRNA end position |
ccagaaatat |
Secondary structure (Cloverleaf model) | >W1510544981 Ile GAT T AAgt ccagaaatat G - C C - G G - C G - C T - A T - A A - T T G T G G T T C A T G A A | | | | | A T C T C G C C A A G C G | | | | T T G G A G C T T A G AGGTC C - G G - C A - T C - G A - T C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |