Sequence ID | >WENV038799 |
Genome ID | AACY021961336 |
Search identical group | |
Phylum/Class | Marine microbial communities from Global Ocean Sampling (GOS) |
Species | |
Start position on genome | 241 |
End posion on genome | 163 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
atcattgtaC |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGTACCTGGCTACGAACCAGGCGGTCGGGAGTTCGAA |
Downstream region at tRNA end position |
Ttggtaagat |
Secondary structure (Cloverleaf model) | >WENV038799 Arg ACG C GCCA Ttggtaagat G - C C - G G - C C - G C - G C - G G - C T A T C T C T C A C G A A | + | | | G T C T C G G G G A G C G | | | + T T G G A G T A T A A CGGTC C - G C - G T - A G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |