Sequence ID | >W1510555198 |
Genome ID | CSZV01000003 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Mycobacteroides abscessus PAP167 [CSZV] |
Start position on genome | 153318 |
End posion on genome | 153404 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
ggagcaagag |
tRNA gene sequence |
GTCCGAGTGGCGGAATGGCAGACGCGCTAGCTTGAGGTGCTAGTGCCCTATTAACGGGCG |
Downstream region at tRNA end position |
ccgcgacacg |
Secondary structure (Cloverleaf model) | >W1510555198 Leu GAG g ACat ccgcgacacg G - C T - A C - G C - G G - C A - T G - C T G T C C C C C A T A A G | | | | | A G G G C G G G G G G C G | | | T T C A C G C A G G TGCCCTATTAACGGGCGT C - G T - A A - T G - C C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |