Sequence ID | >W1510562607 |
Genome ID | CTEH01000002 |
Phylum/Class | Alphaproteobacteria |
Species | Wolbachia endosymbiont of Culex molestus wPip_Mol of Culex molestus [CTEH] |
Start position on genome | 392056 |
End posion on genome | 392131 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
taatacatcT |
tRNA gene sequence |
GCGCTTGTAGCTCAGTTGGATAGAGCGTTGCCCTCCGGAGGCAAAGGTCGCGGGTTCGAA |
Downstream region at tRNA end position |
ttaattaaat |
Secondary structure (Cloverleaf model) | >W1510562607 Arg CCG T GTtt ttaattaaat G - C C - G G - C C - G T - A T - A G - C T A T C T C C C A T G A A | | | | G T C T C G G C G G G C G | | | | T T G G A G C A T A G AGGTC T - A T - A G - C C - G C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |