Sequence ID | >W1510562612 |
Genome ID | CTEH01000002 |
Phylum/Class | Alphaproteobacteria |
Species | Wolbachia endosymbiont of Culex molestus wPip_Mol of Culex molestus [CTEH] |
Start position on genome | 512410 |
End posion on genome | 512325 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
atcacaaaaa |
tRNA gene sequence |
GCCCGGGTGGCGGAATTGGTAGACGCGCTAGCTTCAGGTGCTAGTAACTTTTCAAGTTGT |
Downstream region at tRNA end position |
tgtattgatt |
Secondary structure (Cloverleaf model) | >W1510562612 Leu CAG a ACtc tgtattgatt G - C C - G C - G C - G G - C G - C G - C T G T T C T T C A T A A G + | | | | A T G G C G G G A A G C G | | | T T G A C G C T A G G TAACTTTTCAAGTTGT C - G T - A A - T G - C C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |