Sequence ID | >W1510562616 |
Genome ID | CTEH01000002 |
Phylum/Class | Alphaproteobacteria |
Species | Wolbachia endosymbiont of Culex molestus wPip_Mol of Culex molestus [CTEH] |
Start position on genome | 206959 |
End posion on genome | 206884 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ttataccttg |
tRNA gene sequence |
GCGGGCGTAGCTCAGTTGGTAGAGCGTCAGTTTGTGGTACTGAATGTCGCCAGTTCGATC |
Downstream region at tRNA end position |
ctaaaaattt |
Secondary structure (Cloverleaf model) | >W1510562616 His GTG g CCCA ctaaaaattt G - C C - G G - C G + T G - C C - G G - C C T T T G G T C A T G A A + | | | | G T C T C G G C C A G C G | | | | T T G G A G C T A G ATGTC T - A C - G A - T G - C T - A T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |